View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_240 (Length: 224)
Name: NF0856_low_240
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_240 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 100 - 224
Target Start/End: Complemental strand, 33817410 - 33817286
Alignment:
Q |
100 |
cttctagtgcttgacatcaactctaaatcaccattatccaccggtttagaaatgcccctgctcaacacttcttctgcaagatagaaaagcgagtacactt |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33817410 |
cttctagtgcttgacatcaactctaaatcaccattatccaccagtttagaaatgcccgtgctcaacacttcttctgcaagatagaaaagcgagtacactt |
33817311 |
T |
 |
Q |
200 |
aaagtacacttaaaagtaaccatgt |
224 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
33817310 |
aaagtacacttaaaagtaaccatgt |
33817286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University