View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_242 (Length: 224)
Name: NF0856_low_242
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_242 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 41930301 - 41930168
Alignment:
Q |
1 |
tgaaacagacgatgttcaattgggcctatacatagtaagtaacgtgttttaaatgatggaaatacgactcattattgtatgagtgttcctatgtaaatca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
41930301 |
tgaaacagacgatgttcaattgggcctatacatagtaagtaacgtgttttaaatgatggaaatatgactcattattgtatgagtgttcctatgtaaatca |
41930202 |
T |
 |
Q |
101 |
aagcacacaaaatttcatttagaagatgatgatg |
134 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
41930201 |
aagcacacaaaatttcatttagaagatgatgatg |
41930168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University