View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_251 (Length: 217)
Name: NF0856_low_251
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_251 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 164
Target Start/End: Original strand, 32750128 - 32750284
Alignment:
Q |
8 |
ccaacaatatgaggttgctaagagaaaacattagcacttgtttgatcaaactcaaactatattattccaaaataaggttctcgaaaaagcttaggaaggc |
107 |
Q |
|
|
||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
32750128 |
ccaacaaaatgaggttgctaagagaaaaaatgggcacttgtttgatcaaactcaaactatattatttcaaaataaggttctcgaaaaagcttaggaaggc |
32750227 |
T |
 |
Q |
108 |
agttttagctacatcttatctcataaatcatttgccttctagtgtcttaattccaaa |
164 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32750228 |
agttttagctgcatcttatctcataaatcatttgccttctagtgtcttaattccaaa |
32750284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 50058774 - 50058853
Alignment:
Q |
8 |
ccaacaatatgaggttgctaagagaaaacattagcacttgtttgatcaaactcaaactatattattccaaaataaggttc |
87 |
Q |
|
|
||||||| ||| ||||||| |||||||| || ||| ||||| |||||||||| | |||| ||||||||||||||||||| |
|
|
T |
50058774 |
ccaacaaaatggggttgctgagagaaaaaatgggcatttgttagatcaaactcgagctatgttattccaaaataaggttc |
50058853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 10 - 87
Target Start/End: Complemental strand, 28094660 - 28094583
Alignment:
Q |
10 |
aacaatatgaggttgctaagagaaaacattagcacttgtttgatcaaactcaaactatattattccaaaataaggttc |
87 |
Q |
|
|
||||| ||| ||||||| |||||||| || || ||||| |||||||||||| |||| ||||| ||||||||||||| |
|
|
T |
28094660 |
aacaaaatggggttgctgagagaaaaaatggccatttgttagatcaaactcaagctatgttatttcaaaataaggttc |
28094583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University