View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_low_256 (Length: 214)

Name: NF0856_low_256
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_low_256
NF0856_low_256
[»] chr5 (1 HSPs)
chr5 (82-214)||(33817286-33817418)


Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 82 - 214
Target Start/End: Complemental strand, 33817418 - 33817286
Alignment:
82 catcacagcttctagtgcttgacatcaactctaaatcaccattatccaccggtttagaaatgcccctgctcaacacttcttctgcaagatagaaaagcga 181  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||    
33817418 catcacaacttctagtgcttgacatcaactctaaatcaccattatccaccagtttagaaatgcccgtgctcaacacttcttctgcaagatagaaaagcga 33817319  T
182 gtacacttaaagtacacttaaaagtaaccatgt 214  Q
    |||||||||||||||||||||||||||||||||    
33817318 gtacacttaaagtacacttaaaagtaaccatgt 33817286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University