View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_low_265 (Length: 211)

Name: NF0856_low_265
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_low_265
NF0856_low_265
[»] chr5 (1 HSPs)
chr5 (87-211)||(33817286-33817410)


Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 87 - 211
Target Start/End: Complemental strand, 33817410 - 33817286
Alignment:
87 cttctagtgcttgacatcaactctaaatcaccattatccaccggtttagaaatgcccctgctcaacacttcttctgcaagatagaaaagcgagtacactt 186  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
33817410 cttctagtgcttgacatcaactctaaatcaccattatccaccagtttagaaatgcccgtgctcaacacttcttctgcaagatagaaaagcgagtacactt 33817311  T
187 aaagtacacttaaaagtaaccatgt 211  Q
    |||||||||||||||||||||||||    
33817310 aaagtacacttaaaagtaaccatgt 33817286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2771 times since January 2019
Visitors: 6167