View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_266 (Length: 210)
Name: NF0856_low_266
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_266 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 49 - 200
Target Start/End: Original strand, 10425541 - 10425692
Alignment:
Q |
49 |
ccatttattaattgacactttctgtgttataaatatgacaggccttttggaattggtcatgggatgaacttgttacctatgatctacctgctgtttttga |
148 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
10425541 |
ccatttattaattgacactttctgtgttataaatatgacaggccttttggaattggtcatgggatgaacttgttatctatgatctacctgctgtttttga |
10425640 |
T |
 |
Q |
149 |
ttatgtgttcagccaaacagggcagaagattaattatgttggccattctctg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
10425641 |
ttatgtgttcagccaaacagggcagaagattaattacgttggccattctctg |
10425692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 10425493 - 10425523
Alignment:
Q |
1 |
accttctctaatacataaatttttctttgtc |
31 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
10425493 |
accttctctaatacataaatttttctttgtc |
10425523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University