View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_271 (Length: 208)
Name: NF0856_low_271
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_271 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 4142434 - 4142302
Alignment:
| Q |
1 |
cgttattaccatacaaaataacacagtttatagaatagggttttgtcttcagctctgaacccacccacctacggcggaacttatctctgaggagtgaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4142434 |
cgttattaccatacaaaataacacagtttatagaatagggttttgtcttcagctctgaacccacccacctacggcggaacttatctctgaggagtgaaga |
4142335 |
T |
|
| Q |
101 |
gcagattctgcagaagacttcaacatggttcgt |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4142334 |
gcagattctgcagaagacttcaacatggttcgt |
4142302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1812 times since January 2019
Visitors: 6150