View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0856_low_281 (Length: 202)

Name: NF0856_low_281
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0856_low_281
NF0856_low_281
[»] chr8 (1 HSPs)
chr8 (16-172)||(32750128-32750284)
[»] chr3 (1 HSPs)
chr3 (93-172)||(50058774-50058853)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 16 - 172
Target Start/End: Complemental strand, 32750284 - 32750128
Alignment:
16 tttggaattaagacactagaaggcaaatgatttatgtgataagatgcagctaaaactgccttcctaagctttttcgagaaccttatttttgaataatata 115  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||    
32750284 tttggaattaagacactagaaggcaaatgatttatgagataagatgcagctaaaactgccttcctaagctttttcgagaaccttattttgaaataatata 32750185  T
116 gtttgagtttgatcaaacaagtgctaatgttttctcttagcaacctcatattgttgg 172  Q
    ||||||||||||||||||||||||  || |||||||||||||||||||| |||||||    
32750184 gtttgagtttgatcaaacaagtgcccattttttctcttagcaacctcattttgttgg 32750128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 93 - 172
Target Start/End: Complemental strand, 50058853 - 50058774
Alignment:
93 gaaccttatttttgaataatatagtttgagtttgatcaaacaagtgctaatgttttctcttagcaacctcatattgttgg 172  Q
    |||||||||||| |||||| |||| | |||||||||| ||||| |||  || |||||||| ||||||| ||| |||||||    
50058853 gaaccttattttggaataacatagctcgagtttgatctaacaaatgcccattttttctctcagcaaccccattttgttgg 50058774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2678 times since January 2019
Visitors: 6165