View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_281 (Length: 202)
Name: NF0856_low_281
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_281 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 16 - 172
Target Start/End: Complemental strand, 32750284 - 32750128
Alignment:
| Q |
16 |
tttggaattaagacactagaaggcaaatgatttatgtgataagatgcagctaaaactgccttcctaagctttttcgagaaccttatttttgaataatata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32750284 |
tttggaattaagacactagaaggcaaatgatttatgagataagatgcagctaaaactgccttcctaagctttttcgagaaccttattttgaaataatata |
32750185 |
T |
 |
| Q |
116 |
gtttgagtttgatcaaacaagtgctaatgttttctcttagcaacctcatattgttgg |
172 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
32750184 |
gtttgagtttgatcaaacaagtgcccattttttctcttagcaacctcattttgttgg |
32750128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 93 - 172
Target Start/End: Complemental strand, 50058853 - 50058774
Alignment:
| Q |
93 |
gaaccttatttttgaataatatagtttgagtttgatcaaacaagtgctaatgttttctcttagcaacctcatattgttgg |
172 |
Q |
| |
|
|||||||||||| |||||| |||| | |||||||||| ||||| ||| || |||||||| ||||||| ||| ||||||| |
|
|
| T |
50058853 |
gaaccttattttggaataacatagctcgagtttgatctaacaaatgcccattttttctctcagcaaccccattttgttgg |
50058774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University