View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_51 (Length: 442)
Name: NF0856_low_51
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_51 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 117 - 442
Target Start/End: Complemental strand, 38909742 - 38909420
Alignment:
| Q |
117 |
aatggaaaccaaataccgcttccccgttgaaatgtggcatagaccactaggcaatgttgttgatgtctttgccataaaacaatgatcgatttccagtacc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38909742 |
aatggaaaccaaataccgcttccccgttgaaatgtggcatagaccactaggcaatgttg---atgtctttgccataaaacaatgatcgatttccagtacc |
38909646 |
T |
 |
| Q |
217 |
ccgcaaaattataagctactcaagggttcaagatttttctttaaaacatggaaaagtaaaaacattaaatatttgtcatataaagtcttctatagcttgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38909645 |
ccgcaaaattataagctactcaagggttcaagatttttctttaaaacatggaaaagtaaaaacattaaatatttgtcatataaagtcttctatagcttgt |
38909546 |
T |
 |
| Q |
317 |
tgactttgatcgcatatttgaaatcaatgaaatggtatttaacaaactgcttcacatttcacatcattgcttcactttcacctctgcctggtaaacaagc |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38909545 |
tgactttgatcgcatatttgaaatcaatgaaatggtatttaacaaactgcttcacatttcacatcattgcttcactttcacctctgcctggtaaacaagc |
38909446 |
T |
 |
| Q |
417 |
cagttctgttgtacgaagctggttat |
442 |
Q |
| |
|
| ||| |||||||||||||||||||| |
|
|
| T |
38909445 |
ctgttgtgttgtacgaagctggttat |
38909420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University