View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_57 (Length: 419)
Name: NF0856_low_57
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 8e-74; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 77 - 237
Target Start/End: Complemental strand, 11574571 - 11574412
Alignment:
Q |
77 |
tatccatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgcgtcatt |
176 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
11574571 |
tatcaatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgtgtcatt |
11574472 |
T |
 |
Q |
177 |
tacctagttggatgtgcaataatgccattttgtattctgatagatgcacgatttgcatctt |
237 |
Q |
|
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11574471 |
tacct-gttgcatgtgcaataatgccattttgtattctgatagatgcacgatttgcatctt |
11574412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 28 - 85
Target Start/End: Complemental strand, 11574789 - 11574732
Alignment:
Q |
28 |
gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat |
85 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11574789 |
gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat |
11574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 236 - 290
Target Start/End: Complemental strand, 11574377 - 11574323
Alignment:
Q |
236 |
ttcatacactaataaatcacaatcagagatagatgagactttagaaaaagttaga |
290 |
Q |
|
|
|||||||||||||||||||||||| ||||||| || |||||||||||| ||||| |
|
|
T |
11574377 |
ttcatacactaataaatcacaatcgaagatagacgaaactttagaaaaaattaga |
11574323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 318 - 355
Target Start/End: Complemental strand, 31138465 - 31138428
Alignment:
Q |
318 |
agatcttgcatatattatgcattgtctttatctactga |
355 |
Q |
|
|
||||||||||||||||||||||||||| |||| ||||| |
|
|
T |
31138465 |
agatcttgcatatattatgcattgtctctatcaactga |
31138428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 323 - 360
Target Start/End: Complemental strand, 39438548 - 39438511
Alignment:
Q |
323 |
ttgcatatattatgcattgtctttatctactgaattaa |
360 |
Q |
|
|
||||||||||||||||||||||||||| || ||||||| |
|
|
T |
39438548 |
ttgcatatattatgcattgtctttatcaacagaattaa |
39438511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 2e-22; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 352 - 410
Target Start/End: Complemental strand, 30737398 - 30737340
Alignment:
Q |
352 |
ctgaattaaaccaatgatggggtagaggaaccttgatcttcccttcattattgagttag |
410 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
30737398 |
ctgaattaaaccaatgatggggtagaggaaccttgatcttcccttcattattgaattag |
30737340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 317 - 355
Target Start/End: Complemental strand, 334189 - 334151
Alignment:
Q |
317 |
cagatcttgcatatattatgcattgtctttatctactga |
355 |
Q |
|
|
|||| |||||||||||||||||||||||||||| ||||| |
|
|
T |
334189 |
cagaccttgcatatattatgcattgtctttatcaactga |
334151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 322 - 356
Target Start/End: Original strand, 28046195 - 28046229
Alignment:
Q |
322 |
cttgcatatattatgcattgtctttatctactgaa |
356 |
Q |
|
|
|||||||||||||||||||||||||||| |||||| |
|
|
T |
28046195 |
cttgcatatattatgcattgtctttatcaactgaa |
28046229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 322 - 355
Target Start/End: Complemental strand, 4450306 - 4450273
Alignment:
Q |
322 |
cttgcatatattatgcattgtctttatctactga |
355 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |
|
|
T |
4450306 |
cttgcatatattatgcattgtctttatcaactga |
4450273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 322 - 362
Target Start/End: Complemental strand, 45425497 - 45425457
Alignment:
Q |
322 |
cttgcatatattatgcattgtctttatctactgaattaaac |
362 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |||||| |
|
|
T |
45425497 |
cttgcatatattatgcattgtctttatcaactgagttaaac |
45425457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 320 - 355
Target Start/End: Complemental strand, 25246817 - 25246782
Alignment:
Q |
320 |
atcttgcatatattatgcattgtctttatctactga |
355 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||| |
|
|
T |
25246817 |
atcttgcatatattatgcattgtctttatcaactga |
25246782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 321 - 362
Target Start/End: Complemental strand, 3948099 - 3948058
Alignment:
Q |
321 |
tcttgcatatattatgcattgtctttatctactgaattaaac |
362 |
Q |
|
|
|||||||||||||||||||||||| |||| ||||| |||||| |
|
|
T |
3948099 |
tcttgcatatattatgcattgtctctatcaactgagttaaac |
3948058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 317 - 360
Target Start/End: Original strand, 22354955 - 22354998
Alignment:
Q |
317 |
cagatcttgcatatattatgcattgtctttatctactgaattaa |
360 |
Q |
|
|
||||||||||||||||||||||||||| ||| | |||||||||| |
|
|
T |
22354955 |
cagatcttgcatatattatgcattgtccttaccgactgaattaa |
22354998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 322 - 362
Target Start/End: Original strand, 29896311 - 29896351
Alignment:
Q |
322 |
cttgcatatattatgcattgtctttatctactgaattaaac |
362 |
Q |
|
|
||||||||||||||||||||| | |||| |||||||||||| |
|
|
T |
29896311 |
cttgcatatattatgcattgtttctatcaactgaattaaac |
29896351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 319 - 355
Target Start/End: Original strand, 39068722 - 39068758
Alignment:
Q |
319 |
gatcttgcatatattatgcattgtctttatctactga |
355 |
Q |
|
|
||||||||||||||||||||||||| ||||| ||||| |
|
|
T |
39068722 |
gatcttgcatatattatgcattgtccttatcaactga |
39068758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 317 - 355
Target Start/End: Original strand, 11144677 - 11144715
Alignment:
Q |
317 |
cagatcttgcatatattatgcattgtctttatctactga |
355 |
Q |
|
|
|||| |||||||||||||||||||||||||||| ||||| |
|
|
T |
11144677 |
cagaccttgcatatattatgcattgtctttatcaactga |
11144715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 322 - 355
Target Start/End: Original strand, 43183010 - 43183043
Alignment:
Q |
322 |
cttgcatatattatgcattgtctttatctactga |
355 |
Q |
|
|
|||||||||||||||||||||||||||| ||||| |
|
|
T |
43183010 |
cttgcatatattatgcattgtctttatcaactga |
43183043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 319 - 347
Target Start/End: Original strand, 7922264 - 7922292
Alignment:
Q |
319 |
gatcttgcatatattatgcattgtcttta |
347 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
7922264 |
gatcttgcatatattatgcattgtcttta |
7922292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 320 - 360
Target Start/End: Original strand, 24063223 - 24063263
Alignment:
Q |
320 |
atcttgcatatattatgcattgtctttatctactgaattaa |
360 |
Q |
|
|
||||||||||||||||||||||||| |||| ||||| |||| |
|
|
T |
24063223 |
atcttgcatatattatgcattgtctctatcaactgagttaa |
24063263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 317 - 349
Target Start/End: Complemental strand, 29910510 - 29910478
Alignment:
Q |
317 |
cagatcttgcatatattatgcattgtctttatc |
349 |
Q |
|
|
||||||||||||||||||||||||||| ||||| |
|
|
T |
29910510 |
cagatcttgcatatattatgcattgtccttatc |
29910478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 362
Target Start/End: Complemental strand, 28440008 - 28439963
Alignment:
Q |
317 |
cagatcttgcatatattatgcattgtctttatctactgaattaaac |
362 |
Q |
|
|
|||| ||| ||||||||||||||| |||||||| |||||||||||| |
|
|
T |
28440008 |
cagaccttacatatattatgcattatctttatcaactgaattaaac |
28439963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 322 - 362
Target Start/End: Original strand, 7968957 - 7968997
Alignment:
Q |
322 |
cttgcatatattatgcattgtctttatctactgaattaaac |
362 |
Q |
|
|
|||||||||||||||||||||| ||| | |||||||||||| |
|
|
T |
7968957 |
cttgcatatattatgcattgtccttaccaactgaattaaac |
7968997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 362
Target Start/End: Complemental strand, 40446032 - 40445987
Alignment:
Q |
317 |
cagatcttgcatatattatgcattgtctttatctactgaattaaac |
362 |
Q |
|
|
|||| |||||||||||||||||||||| ||||| ||||| |||||| |
|
|
T |
40446032 |
cagaccttgcatatattatgcattgtccttatcaactgagttaaac |
40445987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 317 - 349
Target Start/End: Original strand, 25607070 - 25607102
Alignment:
Q |
317 |
cagatcttgcatatattatgcattgtctttatc |
349 |
Q |
|
|
|||| |||||||||||||||||||||||||||| |
|
|
T |
25607070 |
cagaccttgcatatattatgcattgtctttatc |
25607102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 320 - 360
Target Start/End: Complemental strand, 31159475 - 31159435
Alignment:
Q |
320 |
atcttgcatatattatgcattgtctttatctactgaattaa |
360 |
Q |
|
|
||||||||||||||||| |||||||||||| ||||| |||| |
|
|
T |
31159475 |
atcttgcatatattatgtattgtctttatcaactgagttaa |
31159435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 322 - 362
Target Start/End: Complemental strand, 34206271 - 34206231
Alignment:
Q |
322 |
cttgcatatattatgcattgtctttatctactgaattaaac |
362 |
Q |
|
|
|||||||||||||||||||||||||| | ||||| |||||| |
|
|
T |
34206271 |
cttgcatatattatgcattgtctttaccaactgagttaaac |
34206231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 319 - 360
Target Start/End: Original strand, 31060221 - 31060262
Alignment:
Q |
319 |
gatcttgcatatattatgcattgtctttatctactgaattaa |
360 |
Q |
|
|
|||||||||||||||||||||| ||| |||| |||||||||| |
|
|
T |
31060221 |
gatcttgcatatattatgcattatctctatcaactgaattaa |
31060262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2564 times since January 2019
Visitors: 6164