View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_65 (Length: 391)
Name: NF0856_low_65
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 102 - 384
Target Start/End: Complemental strand, 11401646 - 11401364
Alignment:
| Q |
102 |
cttacaagtaaagataaaacaaacggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctagaatgcttct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11401646 |
cttacaagtaaagataaaacaaacggtgctccttatcttcaagtggtccagtagtatcatcatttcttaatggtgaagacttgtcttctggaatgcttct |
11401547 |
T |
|
| Q |
202 |
aaaatcttctagtttatgcttgatttaattttcttacagttgtcatttgtcattgttgatattgtttgtgtgacctgtcttgacataatattttgcaatt |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11401546 |
aaaatcttctagtttatgcttgatttaattttcttacggttgtcatttgtcattgtttatattgtttgtgtgacctgtcttgacataatattttaaaatt |
11401447 |
T |
|
| Q |
302 |
aactgaaatttcttttgcacacgttggtgttgactaattgtgtatttcataaaattccatcagaacatcaaggtttcttttct |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
11401446 |
aactgaaatttcttttgcacacgttggtgttgactaattgtgtatttcataaaattccatcaaagcatcaaggtttcttttct |
11401364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2622 times since January 2019
Visitors: 6164