View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_66 (Length: 389)
Name: NF0856_low_66
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 171 - 294
Target Start/End: Complemental strand, 24629683 - 24629578
Alignment:
| Q |
171 |
caatgaacaaagaggttaggaggggttatgaaataacagtccaaccaccacatcaacttcaaccacaccgaacacgcgacatcacaatgaatagatattt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24629683 |
caatgaacaaagaggttaggaggggttatgaaataacagtccaa------------------ccacaccgaacacgcgacatcacaatgaataaatattt |
24629602 |
T |
|
| Q |
271 |
agttacctaagatatgaaattagt |
294 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24629601 |
agttacctaagatatgaaattagt |
24629578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3413 times since January 2019
Visitors: 6174