View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_81 (Length: 374)
Name: NF0856_low_81
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0856_low_81 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 13 - 374
Target Start/End: Complemental strand, 33817652 - 33817286
Alignment:
| Q |
13 |
aatatgacaaaatgaatggtagagaacccacttgaaaaccaataaggtcaacaatatgttgtaatctattat----agagattgaccccgagaaaatagt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33817652 |
aatatgacaaaatgaatggtagagaacccacttgaaaaccagtaaggtcaacaatatgttgtaatctattattattagagattgaccccgagaaaatagt |
33817553 |
T |
|
| Q |
109 |
tgatttgctattgctgaccac-tgaccagaaacctgtgcatatctagtgaaaaggtttatcagtgaatttatgcaagatgccttcccattgcgaaatatc |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33817552 |
tgatttgctattgctgaccacctgaccagaaacctgtgcatatctagtgaaaaggtttatcagtgaatttatgcaagatgccttcccattgctaaatatc |
33817453 |
T |
|
| Q |
208 |
attatgtgatctgcatacaaagtatgaaatggaacatcacagcttctagtgcttgacatcaactctaaatcaccattatccaccggtttagaaatgcccc |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33817452 |
attatgtgatctgcatacaaagtatgaaatggaacatcacaacttctagtgcttgacatcaactctaaatcaccattatccaccagtttagaaatgcccg |
33817353 |
T |
|
| Q |
308 |
tgctcaacacttcttctgcaagatagaaaagcgagtacacttaaagtacacttaaaagtaaccatgt |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817352 |
tgctcaacacttcttctgcaagatagaaaagcgagtacacttaaagtacacttaaaagtaaccatgt |
33817286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3170 times since January 2019
Visitors: 6172