View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_91 (Length: 355)
Name: NF0856_low_91
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_91 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 4e-91; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 92 - 265
Target Start/End: Original strand, 36199055 - 36199228
Alignment:
Q |
92 |
gataagcatcaagtacaagcagaagcagagaatgaattgagtgacacaccttgaagaagatgattctgagtttgttgaagttgatccaactggaagatat |
191 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36199055 |
gataagcatcaagtacaagcagaagcagagaatgaatggagtgacacaccttgaagaagatgattctgagtttgttgaagttgatccaactggaagatat |
36199154 |
T |
 |
Q |
192 |
ggcagagtacaatctctttctcatcatatctcatcattttcattttctctctcctaacttgtatcagtttaatg |
265 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36199155 |
ggcagagtacaatctctttctcatcatatctcatcattttcattttctctctcctaacttgtatcagtttaatg |
36199228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 300 - 347
Target Start/End: Original strand, 36199263 - 36199310
Alignment:
Q |
300 |
agtacaatgaaatccttggcaaaggagcttcaaaaacagtgtatgttt |
347 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
36199263 |
agtacaatgaaatccttggcaaaggagcttcaaagacagtgtatgttt |
36199310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 50
Target Start/End: Original strand, 36198972 - 36199006
Alignment:
Q |
16 |
gaggaaggggcacatacattaatcttaaatcatag |
50 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
36198972 |
gaggaaggggcacatacattaatcttaaatcatag |
36199006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 156 - 202
Target Start/End: Complemental strand, 47006771 - 47006725
Alignment:
Q |
156 |
tctgagtttgttgaagttgatccaactggaagatatggcagagtaca |
202 |
Q |
|
|
||||||||| | ||||||||||| |||||||||||||| |||||||| |
|
|
T |
47006771 |
tctgagtttatagaagttgatcctactggaagatatggaagagtaca |
47006725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 345
Target Start/End: Complemental strand, 47006628 - 47006583
Alignment:
Q |
300 |
agtacaatgaaatccttggcaaaggagcttcaaaaacagtgtatgt |
345 |
Q |
|
|
||||||||||||| |||||||||||||||| || ||||||||||| |
|
|
T |
47006628 |
agtacaatgaaattcttggcaaaggagcttgcaagacagtgtatgt |
47006583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 123 - 200
Target Start/End: Complemental strand, 47355217 - 47355140
Alignment:
Q |
123 |
atgaattgagtgacacaccttgaagaagatgattctgagtttgttgaagttgatccaactggaagatatggcagagta |
200 |
Q |
|
|
|||||||| |||||||| |||||| |||||| ||||| |||||||||||||||||||| || ||||||||||||||| |
|
|
T |
47355217 |
atgaattgtgtgacacagcttgaaacagatgactctgattttgttgaagttgatccaaccggtagatatggcagagta |
47355140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 300 - 344
Target Start/End: Complemental strand, 47355064 - 47355020
Alignment:
Q |
300 |
agtacaatgaaatccttggcaaaggagcttcaaaaacagtgtatg |
344 |
Q |
|
|
||||| ||||||| ||||||||||||||||| ||||||||||||| |
|
|
T |
47355064 |
agtaccatgaaattcttggcaaaggagcttccaaaacagtgtatg |
47355020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2897 times since January 2019
Visitors: 6167