View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_92 (Length: 353)
Name: NF0856_low_92
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_92 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 257
Target Start/End: Complemental strand, 34110320 - 34110073
Alignment:
Q |
10 |
aataatatcaaatagcatgatgcaaccacaccagttacttaacgaggttagttagttaggtaagaattatttatgaagcaccgacacatatatagacatc |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34110320 |
aataatatcaaatagcatgatgcaaccacaccagttacttaacgaggttagttagttaggtaagaattatttatgaagcaccgacacatatatagacatc |
34110221 |
T |
 |
Q |
110 |
tgacacaatctcgacaaacatatatacacactttcaataaaaagtgtagatagagagttatattatgcatgttacctctaactttgtcatcccaacagag |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
34110220 |
tgacacaatctcgacaaacatatatacacactttcaataaaaagtgtagatagagagttatattatgcattttacctctaactttgtcatcccaacagag |
34110121 |
T |
 |
Q |
210 |
caacgtagccaaagtagttttgccagatccagccaaaccggttaaaac |
257 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34110120 |
caacgtagccaaagtagttttgccagatccagccaaaccggttaaaac |
34110073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 178 - 254
Target Start/End: Complemental strand, 34122014 - 34121938
Alignment:
Q |
178 |
atgttacctctaactttgtcatcccaacagagcaacgtagccaaagtagttttgccagatccagccaaaccggttaa |
254 |
Q |
|
|
||||||||| ||||||||||||| ||||| ||||||||||||||||| ||||| || ||||||||||| || ||||| |
|
|
T |
34122014 |
atgttacctataactttgtcatcgcaacatagcaacgtagccaaagtggttttcccggatccagccaagccagttaa |
34121938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1383 times since January 2019
Visitors: 6140