View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0856_low_94 (Length: 349)
Name: NF0856_low_94
Description: NF0856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0856_low_94 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 32750128 - 32750209
Alignment:
Q |
8 |
ccaacaatatgaggttgctaagagaaaacattagaacttgtttgatcaaactcaaactatattattccaaatcaaggttctc |
89 |
Q |
|
|
||||||| |||||||||||||||||||| || | ||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
T |
32750128 |
ccaacaaaatgaggttgctaagagaaaaaatgggcacttgtttgatcaaactcaaactatattatttcaaaataaggttctc |
32750209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University