View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_112 (Length: 214)
Name: NF0857_high_112
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_high_112 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 24 - 135
Target Start/End: Complemental strand, 35418040 - 35417929
Alignment:
Q |
24 |
tgaagcacatcatgttaattagtgagaggagcaaaaccagcatatggtaaccgatacacccgccgggttacattctgatccattataaggcaaccacgtg |
123 |
Q |
|
|
|||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35418040 |
tgaagcacatgaggttaattagtgagaggagcaaagccagcatatggtaaccgatacacccgccgggttacattctgatccattataaggcaaccacgtg |
35417941 |
T |
 |
Q |
124 |
acttctgaaact |
135 |
Q |
|
|
|||||||||||| |
|
|
T |
35417940 |
acttctgaaact |
35417929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University