View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_121 (Length: 202)
Name: NF0857_high_121
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_121 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 19 - 181
Target Start/End: Original strand, 40590869 - 40591031
Alignment:
| Q |
19 |
gacaaaaatctagttgaaacacaagatgaagaacatattgatttacaagaccgaattggtgagttcatggatattgtactttgtacaaatataaaactgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40590869 |
gacaaaaatctagttgaaacacaagatgaagaacatgttgatttacaagaccgaattggtgagttcatggatattgtactttgtacaagtataaaactgg |
40590968 |
T |
 |
| Q |
119 |
aactttattttctgcttatttattgaatatgtattttagtttttccatcattgtctttactct |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40590969 |
aactttattttctgcttatttattgaatatgtattttagtttttccatcattgtctttactct |
40591031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University