View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_122 (Length: 201)
Name: NF0857_high_122
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_high_122 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 38874530 - 38874330
Alignment:
Q |
1 |
aaataactattcatttacaaaacggttatcgaaatgaaagcatgtagttacatacatgagaaccgagtctggcattgtgaaaagctttaagaacacgggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
38874530 |
aaataactattcatttacaaaacggttatcgaaatgaaagcatgtagttacatacatgagaaccaagtctggcattgtgaaaagctttaagaacacgggt |
38874431 |
T |
 |
Q |
101 |
ggtattgtatgcaactaaattatccactgctctgaattctgaattcaatgaatcaacggcttcaataacctgcattgcaacaaaattaactctgaatggt |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38874430 |
ggtattgtatgcaactaaattatccactgctctgaattctgaattcaatgaatcaacggcttcaataacctgcattgcaacaaaattaactctgaatggt |
38874331 |
T |
 |
Q |
201 |
t |
201 |
Q |
|
|
| |
|
|
T |
38874330 |
t |
38874330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3324 times since January 2019
Visitors: 6172