View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_30 (Length: 361)
Name: NF0857_high_30
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 157 - 316
Target Start/End: Original strand, 6711273 - 6711427
Alignment:
| Q |
157 |
aattgcatggtgttcatatttaatctagcaaccttcaataaaatttagaaaattttcatatttcatatgagtgtccttttatagtttctattaatcaact |
256 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6711273 |
aattgcatggtgttcatatttaatcaa-----cttcaataaaatttagaaagttttcatatttcatatgagtgtccttttatagtttctattaatcaact |
6711367 |
T |
 |
| Q |
257 |
tgaatgtacaatttttcctgaattaattagtttaaattttgatatgagaccaattgcatt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6711368 |
tgaatgtacaatttttcctgaattaattagtttaaattttgatatgagaccaattgcatt |
6711427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 30 - 160
Target Start/End: Original strand, 6710859 - 6710990
Alignment:
| Q |
30 |
tgaggtaacatataataacctcctcaaaatctctctagggtgtgctaataatttattaaattgtgatgattgaaaattttagagttttagttcatgagtt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6710859 |
tgaggtaacatataataacctcctcaaaatctctctagggtgtgctaataatttattaaattgtgatgattgaaaattttagagttttagttcatgagtt |
6710958 |
T |
 |
| Q |
130 |
tga-ttgattatcagctgttgtgagatgaatt |
160 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
6710959 |
tgatttgattatcagctgttgtgagatgaatt |
6710990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University