View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_32 (Length: 358)
Name: NF0857_high_32
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 14 - 329
Target Start/End: Complemental strand, 40902899 - 40902584
Alignment:
| Q |
14 |
agagcagaatataaacggtatttaactgagaaaccgatgtaatcttccgtacttaaacgtaaccgagaagccaatgtaatcttccgtatttaaacgtatg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40902899 |
agagcagaatataaacggtatttaactgagaaaccgatgtaatcttccgtacttaaacgtaactgagaaaccaatgtaatcttccgtatttaaacgtatg |
40902800 |
T |
 |
| Q |
114 |
tgtcacgccttcctgcagctgcactgtaggcagggcaatgaccagttcaacagcaggctgattttcttcatggttcagatttggactccaactccatttc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40902799 |
tgtcacgccttcctgcagctgcactgtaggcagggcaatgaccagttcaacagcaggctgattttcttcatggttcagatttcgactccaactccatttc |
40902700 |
T |
 |
| Q |
214 |
cagttctgcacaccatcggatgcagacagtttctgtgctactatgaattgcttgtcagaagctaaactgaacgggtatggaaattgatgacagattggct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40902699 |
cagttctgcacaccatcggatgcagacagtttctgtgctactatgaattgcttgtcagaagctaaactgaacgggtatggaaattgatgacagattggct |
40902600 |
T |
 |
| Q |
314 |
gatccacttgccataa |
329 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
40902599 |
gatccacttgccataa |
40902584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 166 - 299
Target Start/End: Complemental strand, 30149676 - 30149543
Alignment:
| Q |
166 |
gcaggctgattttcttcatggttcagatttggactccaactccatttccagttctgcacaccatcggatgcagacagtttctgtgctactatgaattgct |
265 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||| || ||||||||||||||||| |||||| || |
|
|
| T |
30149676 |
gcaggcagattttgttcatggttcagatttcgactccaacttcatttccagttctgcacaccatcggtctcatacagtttctgtgctactgtgaattcct |
30149577 |
T |
 |
| Q |
266 |
tgtcagaagctaaactgaacgggtatggaaattg |
299 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
30149576 |
tgtcagaagctaaacagaacaggtttggaaattg |
30149543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University