View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_40 (Length: 338)
Name: NF0857_high_40
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 30 - 328
Target Start/End: Original strand, 37769237 - 37769540
Alignment:
| Q |
30 |
agttcaactcttgctgctggtgtgaggtcacaccctcgcagctttgagccatgaggcttggctatggtgaaccctgggacccaactcacctaacctttta |
129 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769237 |
agttcaactctcgctgctggtgtgaggtcacaccctcgcagctttgagccatgaggcttggctatggtgaaccctgggacccaactcacctaacctttta |
37769336 |
T |
 |
| Q |
130 |
ttcgcagc-----tgcaattgcgatcgcaaccaaatcataaagatagttaaaaggggtgctcctaagaataaaaatttctttagcacaagtggaagggca |
224 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769337 |
ttcgcagcgtagctgcaattgcgatcacaaccaaatcataaagatagttaaaaggggtgctcctaagaataaaaatttctttagcacaagtggaagggca |
37769436 |
T |
 |
| Q |
225 |
caagtttcgtgtgttgttatctattcttcccaattgggaggtagctgagattggaagaaacctgaaacatctgttcatgtcaaattttcctgctcttttc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37769437 |
caagtttcgtgtgttgttatctattcttcccaattgggaggtagctgatattggaagaaacctgaaacatctgttcatgtcaaattttcctgctcttttc |
37769536 |
T |
 |
| Q |
325 |
tctg |
328 |
Q |
| |
|
|||| |
|
|
| T |
37769537 |
tctg |
37769540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University