View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_42 (Length: 327)
Name: NF0857_high_42
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 744487 - 744278
Alignment:
| Q |
1 |
cattgatgacaaaataaattagaaaagatggatacaattacaactttaacatactcactttgtcccacttggcctattggatcatgtggcatgtgaccca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
744487 |
cattgatgacaaaataaattagaaaagatggatacaattacaactttaacatactcactttgtcccacttggcctattggatcatgtggcatgtgaccca |
744388 |
T |
|
| Q |
101 |
tacaaactatttctttcacaatgatgctaataatgtgataattcatttttgcatgtttccaaatgaaaggtattaaagttgactcaataagtcattgtat |
200 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
744387 |
tacaaactatttctttaaccatgatgctaataatgtgataattcatttttgcatgtttccaaataaaaggtattaaagttgactcaataagtcattgtat |
744288 |
T |
|
| Q |
201 |
tattttatac |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
744287 |
tattttatac |
744278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3636 times since January 2019
Visitors: 6174