View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_44 (Length: 320)
Name: NF0857_high_44
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 34079145 - 34078952
Alignment:
Q |
1 |
cagcgaggttgaagattctagtgaaggtttgttgattgagaacggcgtcgttttgagggggttgggattgggaagagagagggaaagggttggtgccttt |
100 |
Q |
|
|
||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
34079145 |
cagcgaggttgaagattctggtgaaggtttgttcattgagaacgccgtcgttttgagggggttgggattgggaagagagagggaaagggctggtgccttt |
34079046 |
T |
 |
Q |
101 |
atggagggaaggtccgtaggagagtgtcggaatggtggttgtggagaatgtgttgattggaataaaagaaggtttgtatttgagagtgtaaggg |
194 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34079045 |
atggagggaaggtccgtaggagagtgtctcaatggtggttgtggagaatgtgttgattggaataaaagaaggtttgtatttgagagtgtaaggg |
34078952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 82 - 162
Target Start/End: Complemental strand, 34066037 - 34065957
Alignment:
Q |
82 |
ggaaagggttggtgcctttatggagggaaggtccgtaggagagtgtcggaatggtggttgtggagaatgtgttgattggaa |
162 |
Q |
|
|
||||||| || |||||||| |||||||||||| || ||| ||||| | |||| || |||||||||||||||||||||| |
|
|
T |
34066037 |
ggaaaggttttgtgcctttgtggagggaaggttagtgggaaagtgtgatagtggtagtggtggagaatgtgttgattggaa |
34065957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University