View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_46 (Length: 318)
Name: NF0857_high_46
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 56 - 223
Target Start/End: Complemental strand, 38367019 - 38366852
Alignment:
| Q |
56 |
agatgaaagtcccaccacgtagtagaacgtgttaaaaggagaggttgtgctaacttccaagtaccaaacaagccatataacttagcataagtttctcatc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38367019 |
agatgaaagtcccaccacgtagtagaacgtgttaaaaggaaaggttgtgctaacttccaagtaccaaacaagccatataccttagcataagtttctcatc |
38366920 |
T |
 |
| Q |
156 |
tctctaaccttgaacaattagnnnnnnnaattagcattagcatggaaaataaactttttcttgttttt |
223 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38366919 |
tctctaaccttgaacaattagtttttttaattagcattagcatggaaaataaactttttcttcttttt |
38366852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University