View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_68 (Length: 289)
Name: NF0857_high_68
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 12 - 260
Target Start/End: Complemental strand, 43322548 - 43322297
Alignment:
| Q |
12 |
acagagtaagggacagaccaaacgagaatatttggtggtagtttacggtcttagtgtaccgttgtcggcaaaaccaaccccacgcacgggcaaatgcctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43322548 |
acagagtaagggacagaccaaacgagaatatttggtggtagtttacggtcttagtgtaccgttgtcggcaaaaccaaccccacgcacgggcaaatgcctt |
43322449 |
T |
 |
| Q |
112 |
gacgatcaaaagtggttaattcccaat--caccgg-aggctgaaatgggaccactaatgtacctcaagaaaaagtacgaggttaagtttttcttttgtca |
208 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43322448 |
gacgatcaaaagtggttaattcctaatggcaccggaaggctgaaatgggaccactaatgtacctcaagaaaaagtacgaggttaagtttttcttttgtca |
43322349 |
T |
 |
| Q |
209 |
aatatacacgaggttaagtttgtttaacatattcttttttgttctctaaaat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43322348 |
aatatacacgaggttaagtttgtttaacatattcttttttgttctctaaaat |
43322297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University