View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_69 (Length: 285)
Name: NF0857_high_69
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 31 - 223
Target Start/End: Original strand, 10452641 - 10452830
Alignment:
| Q |
31 |
agaccattttgttaccactaagctagcacatattggactctcaatgcattaaagcaccaataaaaagggccactccnnnnnnnnnnnncaccaataaaag |
130 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
10452641 |
agaccattttgttaccattaagctagcacatattggactctcaatgcattaaagcaccaataaaaagggctactccaaaaaaaaaag-cacgaataaaag |
10452739 |
T |
|
| Q |
131 |
gaataaaaggctctttagcgagaatttcttagaaggtaattgagaatatatttcctagtacattgtatatgatatctgaaactcagaaaatga |
223 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10452740 |
gaataaaaggctctttagagagaatttctta--aggtaattgagaatatatttcctagtacattgtatatgatatctgaaactcagaaaatga |
10452830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3491 times since January 2019
Visitors: 6174