View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_80 (Length: 258)
Name: NF0857_high_80
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_high_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 26 - 229
Target Start/End: Original strand, 8319388 - 8319594
Alignment:
Q |
26 |
attattagcacaacatggtccattattaattcaatcttaactaaaat---cagtcttaccatatccttattaattaagtaggtatctaaacatgaaaacc |
122 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8319388 |
attattagcacaacatggtccattattaattcaatcttaactaaaatgatcagtcttaccatatccttattaattaagtaggtatctaaacatgaaaact |
8319487 |
T |
 |
Q |
123 |
tgtgcttcttgttaaaacatcccttgctttccacttgtatgcttcacgcttaggccattgtcaatttcattctttaatttcattatggtccatgattaat |
222 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8319488 |
tgtgcttcttgttacaacatcccttgctttccacttgtatgcttcacgcttaggccattgtcaatttcattctttaatttcattatggtccatgattaat |
8319587 |
T |
 |
Q |
223 |
taataaa |
229 |
Q |
|
|
||||||| |
|
|
T |
8319588 |
taataaa |
8319594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University