View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_84 (Length: 254)
Name: NF0857_high_84
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_84 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 30 - 236
Target Start/End: Original strand, 4400647 - 4400853
Alignment:
| Q |
30 |
attttgatatcagttaagtttgtgtagtttgtaaacatgattataataacaagcggtttaatttggttgcatattattgaaatggatttcttgattgtta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4400647 |
attttgatatcagttaagtttgtgtagtttgtaaacatgattataataacaagcggtttaatttggttgcatattattgaaatggatttcttgattgtta |
4400746 |
T |
 |
| Q |
130 |
ggcttttc---tagtaattagacatgaaattaaaagttcagaaataaatggtcaattttattggcaaaaaa-aatggtcaattttggatctatttgttta |
225 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4400747 |
ggcttttctagtagtaattagacatgaaattaaaagttcag----aaatggtcaattttattggcaaaaaacaatggtcaattttggatctatttgttta |
4400842 |
T |
 |
| Q |
226 |
aagtgagagtg |
236 |
Q |
| |
|
||||| ||||| |
|
|
| T |
4400843 |
aagtgggagtg |
4400853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University