View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_high_93 (Length: 230)
Name: NF0857_high_93
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_high_93 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 21 - 221
Target Start/End: Complemental strand, 40591031 - 40590831
Alignment:
| Q |
21 |
agagtaaagacaatgatggaaaaactaaaatacatattcaataaataagcagaaaataaagttccagttttatatttgtacaaagtacaatatccatgaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40591031 |
agagtaaagacaatgatggaaaaactaaaatacatattcaataaataagcagaaaataaagttccagttttatacttgtacaaagtacaatatccatgaa |
40590932 |
T |
 |
| Q |
121 |
ctcaccaattcggtcttgtaaatcaatatgttcttcatcttgtgtttcaactagatttttgtccctgttgttcctttctcgggtgtttgtaactttcatc |
220 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40590931 |
ctcaccaattcggtcttgtaaatcaacatgttcttcatcttgtgtttcaactagatttttgtccctgttgttcctttctcgggtgtttgtaactttcatc |
40590832 |
T |
 |
| Q |
221 |
t |
221 |
Q |
| |
|
| |
|
|
| T |
40590831 |
t |
40590831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University