View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_103 (Length: 251)
Name: NF0857_low_103
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_low_103 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 34248291 - 34248533
Alignment:
Q |
1 |
cacaatagcttcttcatgtcgaaaaggatgtccatgtatcttggaaggaatcctagttccatgtccactataatgaaaataaagcacatcccctgcttca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34248291 |
cacaatagcttcttcatgtcgaaaaggatgtccatgtatcttggaaggaatcctagttccatgtccactataatgaaaataaagcacatcccctgcttca |
34248390 |
T |
 |
Q |
101 |
gctttatcaaccatgcttgataatgcttgtttaatgttagcaccagttggcatagttgatgaagagtttttagg---atcatcagtgagaagctgaatat |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
34248391 |
gctttatcaaccatgcttgataatgcttgtttaatgttagcaccagttggcatagttgatgaagagtttttaggatcatcatcagtgagaagctgaatat |
34248490 |
T |
 |
Q |
198 |
tggcatgatcaaacccaaaacgcttcaccaatgtgtccttcat |
240 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34248491 |
tggcatgatcaaacccaaaacgcttcaccaatgtgtccttcat |
34248533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 809 times since January 2019
Visitors: 6131