View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_105 (Length: 249)
Name: NF0857_low_105
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_low_105 |
 |  |
|
[»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 91 - 193
Target Start/End: Complemental strand, 33903886 - 33903784
Alignment:
Q |
91 |
attatactatcaataatttatcagggtcttcttacaaggagagctatatggaataatttatctcatcaattcggttcatatctatcaaaagctatattgc |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33903886 |
attatactatcaataatttatcagggtcttcttacaaggagagctatatggaataatttatctcatcaattcggttcatatctatcaaaagctatattgc |
33903787 |
T |
 |
Q |
191 |
atg |
193 |
Q |
|
|
||| |
|
|
T |
33903786 |
atg |
33903784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 16 - 78
Target Start/End: Complemental strand, 33904173 - 33904111
Alignment:
Q |
16 |
attggtagagaatatgttggtgtttcacaaccaagtcttggtaatgctccaataccatgtgca |
78 |
Q |
|
|
||||||||||| |||||||||||| |||||||||||||||| |||||||||||| |||||| |
|
|
T |
33904173 |
attggtagagatattgttggtgtttcccaaccaagtcttggtagtgctccaataccgtgtgca |
33904111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 16 - 87
Target Start/End: Complemental strand, 148558 - 148486
Alignment:
Q |
16 |
attggtagagaatatgttggtgtttcacaaccaagtcttggtaatgctccaataccatgtgc-atgtggtggg |
87 |
Q |
|
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
T |
148558 |
attggtagagatattgttggtgtttcagaaccaagtcttggtaatgctccaataccgtgtgcaatgtggtggg |
148486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University