View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0857_low_108 (Length: 239)

Name: NF0857_low_108
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0857_low_108
NF0857_low_108
[»] chr8 (2 HSPs)
chr8 (142-239)||(12316414-12316510)
chr8 (16-76)||(12316283-12316343)


Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 142 - 239
Target Start/End: Original strand, 12316414 - 12316510
Alignment:
142 gattattttatactagttcacaatttaatcgatttgctacctttggtcccctccctcatgcatgggaaatttcacatttactcccaaataatttaatc 239  Q
    ||||||||||||||||||||||| ||||||| ||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||    
12316414 gattattttatactagttcacaacttaatcggtttgctaccttcggtccc-tccctcatgcatgggaaatttcacatttactcccaaataatttaatc 12316510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 16 - 76
Target Start/End: Original strand, 12316283 - 12316343
Alignment:
16 gtgcacttgaattgtgctatgtaaaactcattttacgattcatttcaatacctttcaattt 76  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
12316283 gtgcacttgaattgtgttatgtaaaactcattttacgattcatttcaatacctttcaattt 12316343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University