View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_108 (Length: 239)
Name: NF0857_low_108
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_108 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 142 - 239
Target Start/End: Original strand, 12316414 - 12316510
Alignment:
| Q |
142 |
gattattttatactagttcacaatttaatcgatttgctacctttggtcccctccctcatgcatgggaaatttcacatttactcccaaataatttaatc |
239 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12316414 |
gattattttatactagttcacaacttaatcggtttgctaccttcggtccc-tccctcatgcatgggaaatttcacatttactcccaaataatttaatc |
12316510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 16 - 76
Target Start/End: Original strand, 12316283 - 12316343
Alignment:
| Q |
16 |
gtgcacttgaattgtgctatgtaaaactcattttacgattcatttcaatacctttcaattt |
76 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12316283 |
gtgcacttgaattgtgttatgtaaaactcattttacgattcatttcaatacctttcaattt |
12316343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University