View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_110 (Length: 227)
Name: NF0857_low_110
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_110 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 54 - 165
Target Start/End: Complemental strand, 35418040 - 35417929
Alignment:
| Q |
54 |
tgaagcacatcatgttaattagtgagaggagcaaaaccagcatatggtaaccgatacacccgccgggttacattctgatccattataaggcaaccacgtg |
153 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35418040 |
tgaagcacatgaggttaattagtgagaggagcaaagccagcatatggtaaccgatacacccgccgggttacattctgatccattataaggcaaccacgtg |
35417941 |
T |
 |
| Q |
154 |
acttctgaaact |
165 |
Q |
| |
|
|||||||||||| |
|
|
| T |
35417940 |
acttctgaaact |
35417929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University