View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0857_low_111 (Length: 221)

Name: NF0857_low_111
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0857_low_111
NF0857_low_111
[»] chr8 (1 HSPs)
chr8 (1-189)||(38874817-38875005)
[»] chr5 (1 HSPs)
chr5 (2-50)||(18897627-18897675)
[»] chr2 (1 HSPs)
chr2 (2-46)||(15370236-15370280)


Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 38874817 - 38875005
Alignment:
1 tttatgctagtaaataagctcaaataggtcaatcgaaacaggccttaattggttattttggtaatgctgtcagcactttggtggttgcactggttatggt 100  Q
    |||||||||||||||||||||||||| ||||||| ||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
38874817 tttatgctagtaaataagctcaaataagtcaatctaaacatgccctaattggttattttgttaatgctgtcagcactttggtggttgcactggttatggt 38874916  T
101 catgatgaagctggggggcgtgaagctctcgaccaggcttttgcagaaattgttggagcagaatcagctattgttcgttcacaggttct 189  Q
    ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38874917 catgatgaaactggggggcgtgaagctcttgaccaggcttttgcagaaattgttggagcagaatcagctattgttcgttcacaggttct 38875005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 50
Target Start/End: Complemental strand, 18897675 - 18897627
Alignment:
2 ttatgctagtaaataagctcaaataggtcaatcgaaacaggccttaatt 50  Q
    ||||||||||| ||||| |||||||  |||||| |||||||||||||||    
18897675 ttatgctagtagataagttcaaatacttcaatccaaacaggccttaatt 18897627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 15370280 - 15370236
Alignment:
2 ttatgctagtaaataagctcaaataggtcaatcgaaacaggcctt 46  Q
    |||||| |||| ||||||||||||| ||||||| |||||||||||    
15370280 ttatgccagtagataagctcaaataagtcaatccaaacaggcctt 15370236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2639 times since January 2019
Visitors: 6164