View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_111 (Length: 221)
Name: NF0857_low_111
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_111 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 38874817 - 38875005
Alignment:
| Q |
1 |
tttatgctagtaaataagctcaaataggtcaatcgaaacaggccttaattggttattttggtaatgctgtcagcactttggtggttgcactggttatggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38874817 |
tttatgctagtaaataagctcaaataagtcaatctaaacatgccctaattggttattttgttaatgctgtcagcactttggtggttgcactggttatggt |
38874916 |
T |
 |
| Q |
101 |
catgatgaagctggggggcgtgaagctctcgaccaggcttttgcagaaattgttggagcagaatcagctattgttcgttcacaggttct |
189 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38874917 |
catgatgaaactggggggcgtgaagctcttgaccaggcttttgcagaaattgttggagcagaatcagctattgttcgttcacaggttct |
38875005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 50
Target Start/End: Complemental strand, 18897675 - 18897627
Alignment:
| Q |
2 |
ttatgctagtaaataagctcaaataggtcaatcgaaacaggccttaatt |
50 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
18897675 |
ttatgctagtagataagttcaaatacttcaatccaaacaggccttaatt |
18897627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 15370280 - 15370236
Alignment:
| Q |
2 |
ttatgctagtaaataagctcaaataggtcaatcgaaacaggcctt |
46 |
Q |
| |
|
|||||| |||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
15370280 |
ttatgccagtagataagctcaaataagtcaatccaaacaggcctt |
15370236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University