View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_121 (Length: 218)
Name: NF0857_low_121
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_low_121 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 56 - 180
Target Start/End: Original strand, 39890197 - 39890321
Alignment:
Q |
56 |
caactcttttattacctttggtcaaaccaattgaatccaaccccttttctatgatagttcaatgttaatggcggtcacatataatctctattactttaag |
155 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
T |
39890197 |
caactcttttattacctttggtcaaaccaattgaatccaaccccttttctatgatagttcaatgttaatggcggtcacatatactctctattacttgaag |
39890296 |
T |
 |
Q |
156 |
tttttcttctaaaaagacacatttt |
180 |
Q |
|
|
|||| ||| ||||| |||||||||| |
|
|
T |
39890297 |
ttttgcttttaaaacgacacatttt |
39890321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 30 - 99
Target Start/End: Original strand, 39890128 - 39890197
Alignment:
Q |
30 |
gatttgaatataaacatttaacttatcaactcttttattacctttggtcaaaccaattgaatccaacccc |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39890128 |
gatttgaatataaacatttaacttatcaactcttttattacctttggtcaaaccaattgaatccaacccc |
39890197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2476 times since January 2019
Visitors: 6164