View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_129 (Length: 216)
Name: NF0857_low_129
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_129 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 37695314 - 37695389
Alignment:
| Q |
1 |
aaccattttgaagttacttagactgaagggtttgaagaaattctgagattgattcagttgagaataattttgttgg |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37695314 |
aaccattttgaagttacttagactgaagggtttgaagaaattctgaaattgattcagttgagaataattttgttgg |
37695389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 148 - 198
Target Start/End: Original strand, 11764060 - 11764110
Alignment:
| Q |
148 |
ccttataacttatatgaatacagtttcagtttattttactatttgttgatt |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11764060 |
ccttataacttatatgaaaacagtttcagtttattttactatttgttgatt |
11764110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 150 - 186
Target Start/End: Original strand, 781185 - 781221
Alignment:
| Q |
150 |
ttataacttatatgaatacagtttcagtttattttac |
186 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
781185 |
ttataacttatatgaaaacagtttcactttattttac |
781221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2744 times since January 2019
Visitors: 6167