View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0857_low_131 (Length: 206)

Name: NF0857_low_131
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0857_low_131
NF0857_low_131
[»] chr8 (2 HSPs)
chr8 (51-178)||(39890197-39890324)
chr8 (25-94)||(39890128-39890197)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 51 - 178
Target Start/End: Original strand, 39890197 - 39890324
Alignment:
51 caactcttttattacctttggtcaaaccaattgaatccaaccccttttctatgatagttcaatgttaatggcggtcacatatactctctctttctttaag 150  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||    
39890197 caactcttttattacctttggtcaaaccaattgaatccaaccccttttctatgatagttcaatgttaatggcggtcacatatactctctattacttgaag 39890296  T
151 gtttgtttttaaaacgacacaatttcat 178  Q
     |||| ||||||||||||||| ||||||    
39890297 ttttgcttttaaaacgacacattttcat 39890324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 25 - 94
Target Start/End: Original strand, 39890128 - 39890197
Alignment:
25 gatttgaatataaacatttaacttatcaactcttttattacctttggtcaaaccaattgaatccaacccc 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39890128 gatttgaatataaacatttaacttatcaactcttttattacctttggtcaaaccaattgaatccaacccc 39890197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2095 times since January 2019
Visitors: 6156