View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_137 (Length: 204)
Name: NF0857_low_137
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_137 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 56 - 183
Target Start/End: Original strand, 39890197 - 39890324
Alignment:
| Q |
56 |
caactcttttattacctttggtcaaaccaattgaatccaaccccttttctatgatagttcaatgttaatggcggtcacatatactctcttttactttaag |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
39890197 |
caactcttttattacctttggtcaaaccaattgaatccaaccccttttctatgatagttcaatgttaatggcggtcacatatactctctattacttgaag |
39890296 |
T |
|
| Q |
156 |
tttttcttctaaaaagacacattttcat |
183 |
Q |
| |
|
|||| ||| ||||| ||||||||||||| |
|
|
| T |
39890297 |
ttttgcttttaaaacgacacattttcat |
39890324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 30 - 99
Target Start/End: Original strand, 39890128 - 39890197
Alignment:
| Q |
30 |
gatttgaatataaacatttaacttatcaactcttttattacctttggtcaaaccaattgaatccaacccc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39890128 |
gatttgaatataaacatttaacttatcaactcttttattacctttggtcaaaccaattgaatccaacccc |
39890197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2438 times since January 2019
Visitors: 6162