View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_140 (Length: 202)
Name: NF0857_low_140
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_140 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 34870779 - 34870886
Alignment:
| Q |
1 |
atttttagattggggttattctcgtgatgattgtctatcaaaacttgtaagatgaatgattttgtttgagtctgagaaatgaagatgtttatgtaattac |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34870779 |
atttttggattggggttattctcgtgatgattgtctatcaaaacttgtaagatgaatgattttgtttgagtttgagaaatgaagatgtttatgtaattac |
34870878 |
T |
|
| Q |
101 |
gagctcaa |
108 |
Q |
| |
|
||||||| |
|
|
| T |
34870879 |
aagctcaa |
34870886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2868 times since January 2019
Visitors: 6167