View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0857_low_141 (Length: 201)

Name: NF0857_low_141
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0857_low_141
NF0857_low_141
[»] chr8 (1 HSPs)
chr8 (1-201)||(38874330-38874530)


Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 38874530 - 38874330
Alignment:
1 aaataactattcatttacaaaacggttatcgaaatgaaagcatgtagttacatacatgagaaccgagtctggcattgtgaaaagctttaagaacacgggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
38874530 aaataactattcatttacaaaacggttatcgaaatgaaagcatgtagttacatacatgagaaccaagtctggcattgtgaaaagctttaagaacacgggt 38874431  T
101 ggtattgtatgcaactaaattatccactgctctgaattctgaattcaatgaatcaacggcttcaataacctgcattgcaacaaaattaactctgaatggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38874430 ggtattgtatgcaactaaattatccactgctctgaattctgaattcaatgaatcaacggcttcaataacctgcattgcaacaaaattaactctgaatggt 38874331  T
201 t 201  Q
    |    
38874330 t 38874330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University