View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_28 (Length: 420)
Name: NF0857_low_28
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 120 - 405
Target Start/End: Original strand, 42326898 - 42327184
Alignment:
| Q |
120 |
accttgcactgatgtaggttaaaaaattattattaataacggtaacacggttattttacagagataagattttgactatgttctataaagtcaaactctt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42326898 |
accttgcactgatgtaggttaaaaaattattattaataacggtaacacggttattttacagagataagattttgactatgttctgtaaagtcaaactctt |
42326997 |
T |
|
| Q |
220 |
atcgctgggctgagaaaatttaatttattcaagattaatatggaaatgaaaaagaagaagttaattcatgcatgtatgtgtgtaaggatttggttgctta |
319 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42326998 |
atagctgagctgagaaaatttaatttattcaagattaatatggaaatgaaaaagaagaagttaattcatgcatgtatgtgtgtaaggatttggttgctta |
42327097 |
T |
|
| Q |
320 |
cagattgaactgtgtcgatgtatgctttggaagctgtttcaggggaccagacaagtttcattttctcttcggatga-tgtttttgat |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42327098 |
cagattgaactgtgtcgatgtatgctttggaagctgtttcaggggaccagacaagtttcattttctcttcggatgattgtttttgat |
42327184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2881 times since January 2019
Visitors: 6167