View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_35 (Length: 369)
Name: NF0857_low_35
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_35 |
 |  |
|
| [»] scaffold0205 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 28 - 315
Target Start/End: Complemental strand, 53349401 - 53349115
Alignment:
| Q |
28 |
caagctcctcatttttcatatactcttccttcttttttgcaacttctgcctcaatgatattctgatttgctccaaatgctaatctattgtcaacactaat |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53349401 |
caagctcctcatttttcatatactcttccttcttttttgcaacttctgcctcaatgatattctgatttgctccaaatgctaatctattgtcaacactaat |
53349302 |
T |
 |
| Q |
128 |
tttgtatcccacttccaaaagaaaaattgatgataaataatcaaaagagacacataagtatactgtctatccatacataaaatgcatatctaaattttat |
227 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53349301 |
tttgtatcccacttccagaagaaaaattgatgataaataatcaaaagagacacataagtatactgtctatccatacat-aaatgcatatctaaattttat |
53349203 |
T |
 |
| Q |
228 |
ggtatggtttgatccatatagccgatttcacgtgtcaaagttagagtttaacttaattaccactgtagtatgtttttgacagtataat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||| || ||||||||||||||||||||||||| ||||||| |
|
|
| T |
53349202 |
ggtatggtttgatccatatagccgatttcacgtgtccaagttagactttaatttgattaccactgtagtatgtttttgacggtataat |
53349115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0205 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0205
Description:
Target: scaffold0205; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 28 - 102
Target Start/End: Original strand, 20621 - 20695
Alignment:
| Q |
28 |
caagctcctcatttttcatatactcttccttcttttttgcaacttctgcctcaatgatattctgatttgctccaa |
102 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |||||| |||| | |||||||| ||||||| |||||| |
|
|
| T |
20621 |
caagctcctcatggttcagatactcttccttctttcttgcaagttcttcgtcaatgatccgctgatttactccaa |
20695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University