View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_47 (Length: 340)
Name: NF0857_low_47
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 13 - 311
Target Start/End: Original strand, 7720338 - 7720636
Alignment:
| Q |
13 |
aatatgcattattgtaccctgcccgaagaataccaattttctttcctacatctaatttaatttctttaggcacatattatcgtcaagaatcacgttgagt |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7720338 |
aatatgcattattgtaccctgccccaagaataccaattttctttcctacatctaatttaatttctttaggcacatattatcgtcaagaatcacgttgagt |
7720437 |
T |
|
| Q |
113 |
tttcactctagatatttgtcaagaatgacattgagttttcagtttagaatttatgaactaacttttaaaagcattcttgtattatactactacgtactgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7720438 |
tttcactctagatatttgtcaagaatgacattgagttttcagtttagaatttatgaactaacttttaaaagcattcttgtattatactactacgtactgg |
7720537 |
T |
|
| Q |
213 |
catgacactgttctcgcataagcaactgctccaaaaaagcaaagttgtgatgggttttagattccaggcacgaggttactatcatgacgaacttggctt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7720538 |
catgacactgttctcgcataagcaactgctccaaaaaagcaaagttgtgatgggttttagattccaggcacgaggttactatcatgacgaacttggctt |
7720636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3548 times since January 2019
Visitors: 6174