View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_48 (Length: 340)
Name: NF0857_low_48
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 11 - 311
Target Start/End: Original strand, 7720336 - 7720636
Alignment:
Q |
11 |
agaatatgcattattgtaccctgcccgaagaataccaattttctttcctacatctaatttaatttctttaggcacatattatcgtcaagaatcacgttga |
110 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7720336 |
agaatatgcattattgtaccctgccccaagaataccaattttctttcctacatctaatttaatttctttaggcacatattatcgtcaagaatcacgttga |
7720435 |
T |
 |
Q |
111 |
gttttcactctagatatttgtcaagaatgacattgagttttcagtttagaatttatgaactaacttttaaaagcattcttgtattatactactacgtact |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7720436 |
gttttcactctagatatttgtcaagaatgacattgagttttcagtttagaatttatgaactaacttttaaaagcattcttgtattatactactacgtact |
7720535 |
T |
 |
Q |
211 |
ggcatgacactgttctcgcataagcaactgctccaaaaaagcaaagttgtgatgggttttagattccaggcacgaggttactatcatgacgaacttggct |
310 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7720536 |
ggcatgacactgttctcgcataagcaactgctccaaaaaagcaaagttgtgatgggttttagattccaggcacgaggttactatcatgacgaacttggct |
7720635 |
T |
 |
Q |
311 |
t |
311 |
Q |
|
|
| |
|
|
T |
7720636 |
t |
7720636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University