View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_52 (Length: 322)
Name: NF0857_low_52
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 33964828 - 33964598
Alignment:
| Q |
1 |
aatcatttctctctaatggtttttgatgtaagaacacacattttcaacaaactcaaaactgagggagcagttgacacattatcaaaaccatcttaatcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33964828 |
aatcatttctctctaatggtttttgatgtaagaacacacattttcaacaaactcaaaactgagggagcagttgacacattatcaaaaccatcctaatcta |
33964729 |
T |
 |
| Q |
101 |
taaggatacagtagaggaggtcatttcaaatgaagggcattttcctgatcaatacaattgttatgatgaacacggtttgttttttggaccggtcttccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33964728 |
taaggatacagtagaggaggtcatttcaaattaagggcattttcctaatcaatacaattgttatgatgaacacggtttgtgttttggaccggtcttccat |
33964629 |
T |
 |
| Q |
201 |
gctacggatagaacggcctctcttgtgatga |
231 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
33964628 |
gctacggatagaacggcttctcttgtgatga |
33964598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University