View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0857_low_53 (Length: 320)

Name: NF0857_low_53
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0857_low_53
NF0857_low_53
[»] chr2 (2 HSPs)
chr2 (1-194)||(34078952-34079145)
chr2 (82-162)||(34065957-34066037)


Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 34079145 - 34078952
Alignment:
1 cagcgaggttgaagattctagtgaaggtttgttgattgagaacggcgtcgttttgagggggttgggattgggaagagagagggaaagggttggtgccttt 100  Q
    ||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
34079145 cagcgaggttgaagattctggtgaaggtttgttcattgagaacgccgtcgttttgagggggttgggattgggaagagagagggaaagggctggtgccttt 34079046  T
101 atggagggaaggtccgtaggagagtgtcggaatggtggttgtggagaatgtgttgattggaataaaagaaggtttgtatttgagagtgtaaggg 194  Q
    ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34079045 atggagggaaggtccgtaggagagtgtctcaatggtggttgtggagaatgtgttgattggaataaaagaaggtttgtatttgagagtgtaaggg 34078952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 82 - 162
Target Start/End: Complemental strand, 34066037 - 34065957
Alignment:
82 ggaaagggttggtgcctttatggagggaaggtccgtaggagagtgtcggaatggtggttgtggagaatgtgttgattggaa 162  Q
    ||||||| || |||||||| ||||||||||||  || ||| |||||   | |||| || ||||||||||||||||||||||    
34066037 ggaaaggttttgtgcctttgtggagggaaggttagtgggaaagtgtgatagtggtagtggtggagaatgtgttgattggaa 34065957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3129 times since January 2019
Visitors: 6169