View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_56 (Length: 315)
Name: NF0857_low_56
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 104 - 239
Target Start/End: Original strand, 5469459 - 5469594
Alignment:
Q |
104 |
gtagtatgtggtatcttttgtttgaactttgtaatcgttcttggttatattttgcttctgtagattgaaggaacttaaacaatggttgtttacaagttat |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5469459 |
gtagtatgtggtatcttttgtttgaactttgtaatcgttcttggttatattttgcttctgtagattgaaggaacttaaacaatggttgtttacaagttat |
5469558 |
T |
 |
Q |
204 |
tatataatatgctatttaagttacaactttcatctc |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
5469559 |
tatataatatgctatttaagttacaactttcatctc |
5469594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University