View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_58 (Length: 314)
Name: NF0857_low_58
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0857_low_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 29 - 301
Target Start/End: Original strand, 37274094 - 37274366
Alignment:
| Q |
29 |
agaaagttcggccgacgaagggcaacctgagtagcaattgattgtttgcctcttatgattggaagatgtagagttaccatgacctaaccaatcacaattc |
128 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37274094 |
agaaagttccgccgacgaagggcaacctgagtagcaattgattgtttgcctcttatgattggaagatgtagagttaccatgacctaaccaatcacaattc |
37274193 |
T |
|
| Q |
129 |
tgacaaagtgaaactttctcttcagaacacctaaccaaagcaggttgtgaactgcatctctcacacaaaagagtcctcgaatgtcttcgagcaagggtat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37274194 |
tgacaaagtgaaactttctcttcagaacacctaaccaaagcaggttgtgaactgcatctctcacacaaaagagtcctcgaatgtcttcgagctagggtat |
37274293 |
T |
|
| Q |
229 |
ttgctgaatgaacgtttcgatcacatgacaaacataaacatgctgcatcggatcgacagtacaccatcgacct |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37274294 |
ttgctgaatgaacgtttcgatcacatgacaaacataaacatgctgcatcggatcgacagtacaccatcgacct |
37274366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 103 - 152
Target Start/End: Complemental strand, 29458895 - 29458846
Alignment:
| Q |
103 |
taccatgacctaaccaatcacaattctgacaaagtgaaactttctcttca |
152 |
Q |
| |
|
|||||||| || |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29458895 |
taccatgagctgaccaatcacagttctgacaaagtgaaactttctcttca |
29458846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2555 times since January 2019
Visitors: 6164