View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0857_low_82 (Length: 273)
Name: NF0857_low_82
Description: NF0857
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0857_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 22 - 244
Target Start/End: Complemental strand, 48693236 - 48693014
Alignment:
Q |
22 |
atgaaaaacctcaggtgttgttgaataaacaataatacaaacaagccaaattatttatatccgatgatgtttgttgcactttctgtttctttcccaaaaa |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48693236 |
atgaaaaacctcaggtgttgttgaataaacaataatacaaacaagccaaattatttatatccgatgatgtttgttgcactttctgtttctttcccaaaaa |
48693137 |
T |
 |
Q |
122 |
gaaaaacatgttcaaccaatcatggaattgtggaaagagaaaatggatgtttgtggaaagaatgaagtttttaaatacagagaaagccattgctgttccc |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
48693136 |
gaaaaacatgttcaaccaatcatggaattgtggaaagagaaaatggatgtttgtggaaagaatgaattttttaaatacagagaaagccattgctgttccc |
48693037 |
T |
 |
Q |
222 |
ctcgcatttcaaagtgaacccac |
244 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
48693036 |
ctcgcatttcaaagtgaacccac |
48693014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3062 times since January 2019
Visitors: 6169